C3HeB/FeJ-Ergic2mhdaali32/Ieg
| Status | Available to order |
| EMMA ID | EM:01253 |
| Citation information | RRID:IMSR_EM:01253 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C3HeB/FeJ-Ergic2mhdaali32/Ieg |
| Alternative name | ALI032 |
| Strain type | Induced Mutant Strains : Chemically-induced |
| Allele/Transgene symbol | Ergic2mhdaali32 |
| Gene/Transgene symbol | Ergic2 |
Information from provider
| Provider | Martin Hrabe de Angelis |
| Provider affiliation | Institute of Experimental Genetics, Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH) |
| Genetic information | Mutation: Ergic2 148149936, T to C splice site mutation (2nd base following exon 5) on chromosome 6. Primer L: TCAGACAAAACAAGAGCAAATG Primer R: TGTTGGAGCAGATGTACTGG |
| Phenotypic information | Swollen tail and hind paws. |
| References |
|
Information from EMMA
| Archiving centre | Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH), Oberschleißheim, Germany |
Disease and phenotype information
IMPC phenotypes (gene matching)
Literature references
- Genome-wide, large-scale production of mutant mice by ENU mutagenesis.;Hrabé de Angelis M H, Flaswinkel H, Fuchs H, Rathkolb B, Soewarto D, Marschall S, Heffner S, Pargent W, Wuensch K, Jung M, Reis A, Richter T, Alessandrini F, Jakob T, Fuchs E, Kolb H, Kremmer E, Schaeble K, Rollinski B, Roscher A, Peters C, Meitinger T, Strom T, Steckler T, Holsboer F, Klopstock T, Gekeler F, Schindewolf C, Jung T, Avraham K, Behrendt H, Ring J, Zimmer A, Schughart K, Pfeffer K, Wolf E, Balling R, ;2000;Nature genetics;25;444-7; 10932192
- Screening for dysmorphological abnormalities--a powerful tool to isolate new mouse mutants.;Fuchs H, Schughart K, Wolf E, Balling R, Hrabé de Angelis M, ;2000;Mammalian genome : official journal of the International Mammalian Genome Society;11;528-30; 10886017
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).
