C3HeB/FeJ-Ergic2mhdaali32/Ieg

Status

Available to order

EMMA IDEM:01253
Citation informationRRID:IMSR_EM:01253 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

International strain nameC3HeB/FeJ-Ergic2mhdaali32/Ieg
Alternative nameALI032
Strain typeInduced Mutant Strains : Chemically-induced
Allele/Transgene symbolErgic2mhdaali32
Gene/Transgene symbolErgic2

Information from provider

ProviderMartin Hrabe de Angelis
Provider affiliationInstitute of Experimental Genetics, Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH)
Genetic informationMutation: Ergic2 148149936, T to C splice site mutation (2nd base following exon 5) on chromosome 6. Primer L: TCAGACAAAACAAGAGCAAATG Primer R: TGTTGGAGCAGATGTACTGG
Phenotypic informationSwollen tail and hind paws.
References
  • Genome-wide, large-scale production of mutant mice by ENU mutagenesis.;Hrabé de Angelis M H, Flaswinkel H, Fuchs H, Rathkolb B, Soewarto D, Marschall S, Heffner S, Pargent W, Wuensch K, Jung M, Reis A, Richter T, Alessandrini F, Jakob T, Fuchs E, Kolb H, Kremmer E, Schaeble K, Rollinski B, Roscher A, Peters C, Meitinger T, Strom T, Steckler T, Holsboer F, Klopstock T, Gekeler F, Schindewolf C, Jung T, Avraham K, Behrendt H, Ring J, Zimmer A, Schughart K, Pfeffer K, Wolf E, Balling R, ;2000;Nature genetics;25;444-7; 10932192
  • Screening for dysmorphological abnormalities--a powerful tool to isolate new mouse mutants.;Fuchs H, Schughart K, Wolf E, Balling R, Hrabé de Angelis M, ;2000;Mammalian genome : official journal of the International Mammalian Genome Society;11;528-30; 10886017

Information from EMMA

Archiving centreHelmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH), Oberschleißheim, Germany

Disease and phenotype information

IMPC phenotypes (gene matching)
  • abnormal seminal vesicle morphology / IMPC
  • increased circulating iron level / IMPC
  • long tibia / IMPC
  • preweaning lethality, incomplete penetrance / IMPC
  • increased heart weight / IMPC

Literature references

  • Genome-wide, large-scale production of mutant mice by ENU mutagenesis.;Hrabé de Angelis M H, Flaswinkel H, Fuchs H, Rathkolb B, Soewarto D, Marschall S, Heffner S, Pargent W, Wuensch K, Jung M, Reis A, Richter T, Alessandrini F, Jakob T, Fuchs E, Kolb H, Kremmer E, Schaeble K, Rollinski B, Roscher A, Peters C, Meitinger T, Strom T, Steckler T, Holsboer F, Klopstock T, Gekeler F, Schindewolf C, Jung T, Avraham K, Behrendt H, Ring J, Zimmer A, Schughart K, Pfeffer K, Wolf E, Balling R, ;2000;Nature genetics;25;444-7; 10932192
  • Screening for dysmorphological abnormalities--a powerful tool to isolate new mouse mutants.;Fuchs H, Schughart K, Wolf E, Balling R, Hrabé de Angelis M, ;2000;Mammalian genome : official journal of the International Mammalian Genome Society;11;528-30; 10886017

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable).

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).