C3HeB/FeJ-Mmp20^m1Mhda/Ieg

Status	Available to order
EMMA ID	EM:01257
Citation information	RRID:IMSR_EM:01257 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.
International strain name	C3HeB/FeJ-Mmp20^m1Mhda/Ieg
Alternative name	ATE004
Strain type	Induced Mutant Strains : Chemically-induced
Allele/Transgene symbol	Mmp20^m1Mhda
Gene/Transgene symbol	Mmp20

Information from provider

Provider	Martin Hrabe de Angelis
Provider affiliation	Institute of Experimental Genetics, Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH)
Genetic information	Mutation: Mmp20 exon 8, c.1240 T to A, p.Y414N on chromosome 9. Primer L: GCAACGAATAGATGCTGCTG Primer R: GCAGGCTTATTGTTAAGTAGCTTGTC
Phenotypic information	Model for Amelogenesis Imperfecta, Hypomaturation Type (OMIM 612529)
References	Genome-wide, large-scale production of mutant mice by ENU mutagenesis.;Hrabé de Angelis M H, Flaswinkel H, Fuchs H, Rathkolb B, Soewarto D, Marschall S, Heffner S, Pargent W, Wuensch K, Jung M, Reis A, Richter T, Alessandrini F, Jakob T, Fuchs E, Kolb H, Kremmer E, Schaeble K, Rollinski B, Roscher A, Peters C, Meitinger T, Strom T, Steckler T, Holsboer F, Klopstock T, Gekeler F, Schindewolf C, Jung T, Avraham K, Behrendt H, Ring J, Zimmer A, Schughart K, Pfeffer K, Wolf E, Balling R, ;2000;Nature genetics;25;444-7; 10932192 Screening for dysmorphological abnormalities--a powerful tool to isolate new mouse mutants.;Fuchs H, Schughart K, Wolf E, Balling R, Hrabé de Angelis M, ;2000;Mammalian genome : official journal of the International Mammalian Genome Society;11;528-30; 10886017

Information from EMMA

Archiving centre	Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH), Oberschleißheim, Germany

Disease and phenotype information

Orphanet associated rare diseases, based on orthologous gene matching

Hypomaturation amelogenesis imperfecta / Orphanet_100033

IMPC phenotypes (gene matching)

abnormal tooth color / IMPC
abnormal tooth morphology / IMPC
decreased body weight / IMPC
abnormal thymus morphology / IMPC
increased CD4-positive, CD25-positive, alpha-beta regulatory T cell number / IMPC
enlarged thymus / IMPC
decreased lean body mass / IMPC
decreased respiratory quotient / IMPC
increased total body fat amount / IMPC
abnormal spleen morphology / IMPC
small seminal vesicle / IMPC
increased prepulse inhibition / IMPC
abnormal seminal vesicle morphology / IMPC

MGI phenotypes (gene matching)

abnormal tooth morphology / MGI
abnormal enamel morphology / MGI
reduced enamel thickness / MGI
delaminated enamel / MGI
abnormal enamel rod pattern / MGI
abnormal ameloblast morphology / MGI

Literature references

Genome-wide, large-scale production of mutant mice by ENU mutagenesis.;Hrabé de Angelis M H, Flaswinkel H, Fuchs H, Rathkolb B, Soewarto D, Marschall S, Heffner S, Pargent W, Wuensch K, Jung M, Reis A, Richter T, Alessandrini F, Jakob T, Fuchs E, Kolb H, Kremmer E, Schaeble K, Rollinski B, Roscher A, Peters C, Meitinger T, Strom T, Steckler T, Holsboer F, Klopstock T, Gekeler F, Schindewolf C, Jung T, Avraham K, Behrendt H, Ring J, Zimmer A, Schughart K, Pfeffer K, Wolf E, Balling R, ;2000;Nature genetics;25;444-7; 10932192
Screening for dysmorphological abnormalities--a powerful tool to isolate new mouse mutants.;Fuchs H, Schughart K, Wolf E, Balling R, Hrabé de Angelis M, ;2000;Mammalian genome : official journal of the International Mammalian Genome Society;11;528-30; 10886017

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740^*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

^* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable).

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.
Not found what you were looking for? Search here for other strains available from EMMA.

C3HeB/FeJ-Mmp20m1Mhda/Ieg