IMPC phenotypes (gene matching)
- increased exploration in new environment / IMPC
C57BL/6J-Cntnap2em1Cnbc/Cnbc
| Status | Available to order |
| EMMA ID | EM:14761 |
| Citation information | RRID:IMSR_EM:14761 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6J-Cntnap2em1Cnbc/Cnbc |
| Alternative name | Cntnap2 Ile236Ser |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Cntnap2em1Cnbc |
| Gene/Transgene symbol | Cntnap2 |
Information from provider
| Provider | Lluis Montoliu |
| Provider affiliation | CNB Mouse Embryo Cryopreservation Facility, National Centre for Biotechnology (CNB-CSIC) |
| Genetic information | Mouse strain generated by genome editing with CRISPR/Cas9 tools with the mutation Ile236Ser (I236S) introduced in the Cntnap2 gene using a gRNA in exon 5 of the gene (5'-GCAAGGGGATTACATTACTT-3') and the following ssDNA oligonucleotide for repair: 5'-GAAGGAGTACTTTTGCATGGTGAAGGACAGCAAGGGGATTACAGTACTT TGGAACTGAAAAAAGCAAAGCTGGTCCTCAGTTTAAATCTA-3'. |
| Phenotypic information | Homozygous:Homozygous mice for this mutation have not been obtained, therefore their phenotype is unknown. According to the literature available the homozygous mutation might be pathogenic and display some features of Autism Spectrum Disorders (ASD).Heterozygous:Heterozygous mice carrying the Cntnap2 Ile236Ser mutation do not display any obvious phenotype. |
| Breeding history | C57BL/6J fertilized oocytes were electroporated with CRISPR/Cas9 reagents and the resulting mutant mice have been bred since then with C57BL/6J partners. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | CNB-CSIC, Centro Nacional de Biotecnologia, Madrid, Spain |
| Animals used for archiving | heterozygous C57BL/6J males, wild-type C57BL/6J females |
| Stage of embryos | 2-cell |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Pitt-Hopkins-like syndrome / Orphanet_221150
- Cortical dysplasia-focal epilepsy syndrome / Orphanet_163681
MGI phenotypes (gene matching)
- abnormal corpus callosum morphology / MGI
- decreased body size / MGI
- social withdrawal / MGI
- hyperactivity / MGI
- increased stereotypic behavior / MGI
- increased grooming behavior / MGI
- abnormal nest building behavior / MGI
- abnormal motor coordination/balance / MGI
- abnormal olfaction / MGI
- seizures / MGI
- astrocytosis / MGI
- abnormal response to novel odor / MGI
- nervous system phenotype / MGI
- decreased thermal nociceptive threshold / MGI
- abnormal brain interneuron morphology / MGI
- abnormal neuron physiology / MGI
- abnormal brain wave pattern / MGI
- behavior/neurological phenotype / MGI
- abnormal neuronal migration / MGI
- environmentally induced seizures / MGI
- cognitive inflexibility / MGI
- abnormal inhibitory learning / MGI
- decreased vocalization / MGI