Dp(10Prtm2 - Gm48276)1EmcfTyb

Status	Available to order
EMMA ID	EM:15935
Citation information	RRID:IMSR_EM:15935 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.
International strain name	Dp(10Prtm2 - Gm48276)1EmcfTyb
Alternative name	Dp(10Prtm2 - Gm48276)1EmcfTyb
Strain type	Endonuclease-mediated
Allele/Transgene symbol	Dp(10Prtm2-Gm48276)1EmcfTyb
Gene/Transgene symbol	Dp(10Prtm2-Gm48276)1EmcfTyb

Information from provider

Provider	Elizabeth Fisher
Provider affiliation	Neuromuscular Diseases, UCL Queen Square Institute of Neurology
Additional owner	Prof. Victor Tybulewicz, The Francis Crick Institute, London, UK
Genetic information	Duplication of 0.5Mb of Mmu10 encompassing genes from Prtm2 to Gm48276 A loxP site was targeted to Mmu10 at 76039809 and a second loxP site was targeted to Mmu10 at 76595209. Insertion of loxP sites was carried out via CRISPR-Cas9 electroporation with donor sequences containing a loxP site sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT), using these guides: GGAATCATGTCTAGGTTCCG and GAGTCTTGGATGCCGAGTGA, respectively into C57BL6/J embryos. Mice heterozygous for each LoxP site were crossed with an Hprt-Cre expressing animal and after in vivo recombination we screened for animals that had a duplication between the two loxP sites and which are thus hemizygous for the genes in this region, which spans from Prtm2 to Gm48276 including these two genes. All coordinates provided were using mm39.
Phenotypic information	Homozygous: Not known Heterozygous: Not known
Breeding history	More than 5 backcrosses to C57BL/6J
References	None available
Homozygous fertile	not known
Homozygous viable	not known
Homozygous matings required	no
Immunocompromised	no

Information from EMMA

Archiving centre	Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Rederivation of mice from frozen stock, delivery time available upon request . €3880^*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

^* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
MTA will be issued after an order has been submitted.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.
Not found what you were looking for? Search here for other strains available from EMMA.