C57BL/6J-Lrrk2em1(EGFP-IRES-Bromotag)H/H
| Status | Available to order |
| EMMA ID | EM:16084 |
| Citation information | RRID:IMSR_EM:16084 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6J-Lrrk2em1(EGFP-IRES-Bromotag)H/H |
| Alternative name | C57BL/6J-Lrrk2 |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Lrrk2em1(EGFP-IRES-Bromotag)H |
| Gene/Transgene symbol | Lrrk2 |
Information from provider
| Provider | Reva Biju |
| Provider affiliation | Mary Lyon Centre at MRC Harwell |
| Genetic information | This strain carries a knock-in of EGFP-IRES-Bromotag into exon ENSMUSE00000503724 of the Lrrk2 gene made by Pronuclear injection of CRISPR/Cas9 reagents, SgRNA protospacer sequence CTGACAGGCGCCACTGGCCA and GCCGGCTGCACCATGGCCAG, a PAM sequence TGG, and a donor oligo sequence carrying the BromoTag into 1-cell stage embryos. This strain can be useful for studying the role of LRRK2 and the LRRK2 pathway in the pathogenesis of Parkinson's disease. |
| Phenotypic information | Homozygous:LRRK2 phosphorylates a subgroup of Rab GTPase proteins (including Rab10 and Rab12). These proteins when phosphorylated, interact with RILPL1 which intereferes with Ciliogenesis and disrupts the Sonic hedgehog neuroprotective circuit that supports dopaminergic neurons. Studying the role of LRRK2 and the LRRK2 pathway may therefore be useful in studying the pathogenesis of Parkinson's disease. This strain shows a significant reduction in the LRRK2 protein levels in all tissue types in homozygotes. The decreased expression of LRRK2 leads to lower phosphorylation levels of Rab10 and Rab12 thus suggesting that the LRRK2-BromoTag knock-in impacts basal LRRK2 levels. (further phenotyping data in attached file)Heterozygous:In heterozygous animals, decreased expression of LRRK2 leads to lower phosphorylation levels of Rab10 and Rab12 thus suggesting that the LRRK2-BromoTag knock-in impacts basal LRRK2 levels. |
| Breeding history | This strain is coisogenic on C57BL/6J |
| References | None available |
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Hereditary late-onset Parkinson disease / Orphanet_411602