C57BL/6NCrl-Nr2f1^em1Ics/Ics

Status	Available to order
EMMA ID	EM:16193
Citation information	RRID:IMSR_EM:16193 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.
International strain name	C57BL/6NCrl-Nr2f1^em1Ics/Ics
Alternative name	Nr2f1em1Ics/Ics
Strain type	Endonuclease-mediated
Allele/Transgene symbol	Nr2f1^em1Ics
Gene/Transgene symbol	Nr2f1

Information from provider

Provider	Michele Studer
Provider affiliation	Physiological and Pathological Mechanisms of Neural Development Lab, Institute of Biology Valrose, i, CNRS 7277- Inserm 1091-Univ. Côte d’Azur (UniCA) Centre de Biochimie
Genetic information	CRISPR/Cas9 technology generated a glutamic acid 397 (GAA) to TGA stop codon change (c.1189-1190delGAinsTG, p.E397*) in exon 3. A silent mutation also introduced an NdeI restriction site. A single guided RNA TCTCGGATGAGAGTTTCGAT was selected for the position of the putative double stand break being close to the mutation to introduce. A single stranded phosphorothioate oligonucleotide (donor ssODN) was used, with the following sequence: TGTCCTCCTCTGTCATCGAGCAACTCTTCTTCGTACGTTTGGTAGGTAAAACTCCCATATGAACTCTCATCCGAGATATGTTGCTGTCAGGGAGCAGTTTCAACTGGCCTTACATGTCCA .
Phenotypic information	Homozygous: N/A Heterozygous: N/A
Breeding history	C57BL/6NCrl 100%
References	Models of Bosch-Boonstra-Schaaf optic atrophy syndrome reveal genotype-phenotype correlations in brain structure and behavior.;Maass Johann G, Kamionek Dominik, Mantilleri Annabelle, Theiss Susanne, Dötsch Laura, Franke Felix, Schubert Tim, Scheck Jonas G, Pitzer Claudia, Piovani Paolo, Bertacchi Michele, Deschaux Olivier, Singh Anubhav, Chen Chun-An, Fröhlich Henning, Studer Michèle, Schaaf Christian P, ;2025;Disease models & mechanisms;18;; 40855817
Homozygous fertile	not known
Homozygous viable	not known
Homozygous matings required	no
Immunocompromised	no

Information from EMMA

Archiving centre	ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

Orphanet associated rare diseases, based on orthologous gene matching

Optic atrophy-intellectual disability syndrome / Orphanet_401777

IMPC phenotypes (gene matching)

preweaning lethality, complete penetrance / IMPC
embryonic growth retardation / IMPC
persistence of hyaloid vascular system / IMPC
abnormal auditory brainstem response / IMPC

MGI phenotypes (gene matching)

abnormal corpus callosum morphology / MGI
abnormal cerebral cortex morphology / MGI
absent barrels in primary somatosensory cortex / MGI
abnormal glossopharyngeal ganglion morphology / MGI
no swallowing reflex / MGI
abnormal hearing physiology / MGI
no abnormal phenotype detected / MGI
abnormal brain commissure morphology / MGI
abnormal neuron morphology / MGI
abnormal axon guidance / MGI
no phenotypic analysis / MGI
abnormal cochlear sensory epithelium morphology / MGI
nervous system phenotype / MGI
abnormal cingulate gyrus morphology / MGI
increased cochlear inner hair cell number / MGI
increased cochlear outer hair cell number / MGI
increased cochlear hair cell number / MGI
abnormal orientation of outer hair cell stereociliary bundles / MGI
abnormal orientation of inner hair cell stereociliary bundles / MGI
abnormal cochlear hair cell development / MGI
increased Deiters cell number / MGI
abnormal axon morphology / MGI
abnormal hippocampal commissure morphology / MGI
abnormal anterior commissure morphology / MGI
abnormal organ of Corti supporting cell differentiation / MGI
short scala media / MGI
neonatal lethality, incomplete penetrance / MGI
perinatal lethality, complete penetrance / MGI

Literature references

Models of Bosch-Boonstra-Schaaf optic atrophy syndrome reveal genotype-phenotype correlations in brain structure and behavior.;Maass Johann G, Kamionek Dominik, Mantilleri Annabelle, Theiss Susanne, Dötsch Laura, Franke Felix, Schubert Tim, Scheck Jonas G, Pitzer Claudia, Piovani Paolo, Bertacchi Michele, Deschaux Olivier, Singh Anubhav, Chen Chun-An, Fröhlich Henning, Studer Michèle, Schaaf Christian P, ;2025;Disease models & mechanisms;18;; 40855817

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740^*
Rederivation of mice from frozen stock, delivery time available upon request . €3880^*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

^* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.
Not found what you were looking for? Search here for other strains available from EMMA.

C57BL/6NCrl-Nr2f1em1Ics/Ics