C57BL/6NCrl-Orc1^em1Ics/Ics

Status	Available to order
EMMA ID	EM:16195
Citation information	RRID:IMSR_EM:16195 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.
International strain name	C57BL/6NCrl-Orc1^em1Ics/Ics
Alternative name	Orc1em1Ics/Ics
Strain type	Endonuclease-mediated
Allele/Transgene symbol	Orc1^em1Ics
Gene/Transgene symbol	Orc1

Information from provider

Provider	Benoit Miotto
Provider affiliation
Genetic information	The arginine codon 104 (CGC) in exon 4 (ENSMUSE00001307667) was changed to glutamine (CAG; c.311_312delGCinsAG p.R104Q) using CRISPR/Cas9 technology with an sgRNA (equivalent to AGGCCGCAGTCCTCCTGCAC) and an ssODN template (CAATGATGGTCTCCACATTAATCTTGTTATCCCAGTCAGAACAGTCATACCAGAATATCTCCTGTGCCGGCGGACTCTGGCCTAACAAGTGCCTTTTAGAGACAGGAATCTCAAGGAATCTGACAAACC).
Phenotypic information	Homozygous: N/A Heterozygous: N/A
Breeding history	C57BL/6NCrl 100%
References	None available
Homozygous fertile	not known
Homozygous viable	yes
Homozygous matings required	no
Immunocompromised	no

Information from EMMA

Archiving centre	ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

Orphanet associated rare diseases, based on orthologous gene matching

Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome / Orphanet_415
Ear-patella-short stature syndrome / Orphanet_2554

IMPC phenotypes (gene matching)

preweaning lethality, complete penetrance / IMPC
embryonic lethality prior to organogenesis / IMPC
increased lean body mass / IMPC
increased bone mineral content / IMPC
increased grip strength / IMPC
prenatal lethality prior to heart atrial septation / IMPC
increased bone mineral density / IMPC
decreased total body fat amount / IMPC

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740^*
Rederivation of mice from frozen stock, delivery time available upon request . €3880^*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

^* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.
Not found what you were looking for? Search here for other strains available from EMMA.

INFRAFRONTIER^® and European Mouse Mutant Archive - EMMA^® are registered trademarks at the European Union Intellectual Property Office (EUIPO).

C57BL/6NCrl-Orc1em1Ics/Ics