C57BL/6NCrl-Cckar^em1Ics/Ics

Status	Available to order
EMMA ID	EM:16209
Citation information	RRID:IMSR_EM:16209 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.
International strain name	C57BL/6NCrl-Cckar^em1Ics/Ics
Alternative name	Cckarem1Ics/Ics
Strain type	Endonuclease-mediated
Allele/Transgene symbol	Cckar^em1Ics
Gene/Transgene symbol	Cckar

Information from provider

Provider	Thierry Bienvenu
Provider affiliation	Service de Génétique et Biologie Moléculaires, AP-HP Centre - Université Paris Cité
Genetic information	The cysteine codon 395 (TGT) in exon 5 (ENSMUSE00000360827) was changed to tyrosine (TAT; c.1184G>A p.C395Y) using CRISPR/Cas9 technology with an sgRNA (equivalent to GTTGCCCGAATCCTGGTCCC) and an ssODN template (CCATTATCTACTGCTTCATGAACAAACGCTTTCGCCTGGGCTTCATGGCCACCTTCCCCTATTGCCCTAATCCAGGTCCCACCGGGGTGAGAGGAGAAGTGGGAGAGGAGGAAGATGGAAGGACCATAAG). A silent mutation was introduced to generate an EcoNI diagnostic restriction site.
Phenotypic information	Homozygous: N/A Heterozygous: N/A
Breeding history	100% C57BL/6NCrl
References	None available
Homozygous fertile	not known
Homozygous viable	not known
Homozygous matings required	no
Immunocompromised	no

Information from EMMA

Archiving centre	ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

IMPC phenotypes (gene matching)

increased circulating aspartate transaminase level / IMPC
enlarged urinary bladder / IMPC

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740^*
Rederivation of mice from frozen stock, delivery time available upon request . €3880^*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

^* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.
Not found what you were looking for? Search here for other strains available from EMMA.

INFRAFRONTIER^® and European Mouse Mutant Archive - EMMA^® are registered trademarks at the European Union Intellectual Property Office (EUIPO).

C57BL/6NCrl-Cckarem1Ics/Ics