C57BL/6NCrl-Grin2bem1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16214 |
| Citation information | RRID:IMSR_EM:16214 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Grin2bem1Ics/Ics |
| Alternative name | Grin2bem1Ics/Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Grin2bem1Ics |
| Gene/Transgene symbol | Grin2b |
Information from provider
| Provider | Pierre Paoletti |
| Provider affiliation | CNRS UMR 8197 - Inserm U 1024, Institut de Biologie de l |
| Genetic information | The arginine codon 187 (CGC) in exon 4 (ENSMUSE00001296739) was changed to cysteine (TGC; c.559C>T p.R187C) using CRISPR/Cas9 technology with an sgRNA (equivalent to cagcactattgagaacagct) and an ssODN template (CATCTTCTCCATCGTCACCACCTACTTCCCCGGCTACCAGGACTTCGTGAACAAGATCTGCAGCACTATTGAGAACAGCTTTGTGGGCTGGGAGCTCGAGGAAGTCCTCCTGCTAGACATGTCTCTAGAC). A silent mutation was introduced to generate a BglII diagnostic restriction site. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- West syndrome / Orphanet_3451
- Autosomal dominant non-syndromic intellectual disability / Orphanet_178469
- GRIN2B-related developmental delay, intellectual disability and autism spectrum disorder / Orphanet_589547
IMPC phenotypes (gene matching)
MGI phenotypes (gene matching)
- disorganized barrel cortex / MGI
- decreased body size / MGI
- abnormal social investigation / MGI
- social withdrawal / MGI
- decreased anxiety-related response / MGI
- hyperactivity / MGI
- impaired coordination / MGI
- absent suckling reflex / MGI
- abnormal suckling behavior / MGI
- abnormal cued conditioning behavior / MGI
- abnormal temporal memory / MGI
- reduced long term potentiation / MGI
- increased startle reflex / MGI
- abnormal long term depression / MGI
- absent long term depression / MGI
- impaired synaptic plasticity / MGI
- absence of NMDA-mediated synaptic currents / MGI
- perinatal lethality / MGI
- abnormal CNS synaptic transmission / MGI
- abnormal social/conspecific interaction / MGI
- abnormal operant conditioning behavior / MGI
- abnormal AMPA-mediated synaptic currents / MGI
- abnormal NMDA-mediated synaptic currents / MGI
- abnormal excitatory postsynaptic potential / MGI
- enhanced long term potentiation / MGI
- nervous system phenotype / MGI
- abnormal nervous system physiology / MGI
- abnormal miniature excitatory postsynaptic currents / MGI
- behavior/neurological phenotype / MGI
- increased prepulse inhibition / MGI
- absent gastric milk in neonates / MGI
- postnatal lethality, complete penetrance / MGI
- neonatal lethality, complete penetrance / MGI
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).
