IMPC phenotypes (gene matching)
C57BL/6NCrl-Htttm5.1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16215 |
| Citation information | RRID:IMSR_EM:16215 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Htttm5.1Ics/Ics |
| Alternative name | Htttm3.1Ics/Ics |
| Strain type | Targeted Mutant Strains : Knock-in |
| Allele/Transgene symbol | Htttm5.1Ics |
| Gene/Transgene symbol | Htt |
Information from provider
| Provider | Frédéric Saudou |
| Provider affiliation | Grenoble Institut des Neurosciences (GIN) |
| Genetic information | The aspartic acid 564 (GAT) in exon 13 (ENSMUSE00001232286) was replaced by a glutamic acid, an asparagine, a leucine, a tyrosine, a phenylalanine, a glutamine and a serine coding sequence (GAA AAC CTG TAC TTC CAG TCC; c.1691_1692delATins AAAACCTGTACTTCCAGTCC p.D564ENLYFQS). A floxed neoR-protamine cre selection cassette was inserted and auto-excised upstream exon 13 leaving a single loxP site. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |