IMPC phenotypes (gene matching)
C57BL/6NCrl-Lhcgrem1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16216 |
| Citation information | RRID:IMSR_EM:16216 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Lhcgrem1Ics/Ics |
| Alternative name | Lhcgrem1Ics/Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Lhcgrem1Ics |
| Gene/Transgene symbol | Lhcgr |
Information from provider
| Provider | Jacques Young |
| Provider affiliation | Service d’Endocrinologie, Hôpital Bicêtre |
| Genetic information | CRISPR/Cas9 technology generated a methionine 509 to threonine amino acid change (c.1538T>C, p.M513T) in exon 11 (ENSMUSE00000408834). A silent mutation also introduced a ClaI restriction site. Two guided RNA CATCTGCCTCCCCATGGATG and GATGGCCACATTGCCCCTTG were selected for the position of the putative double stand break being close to the mutation to introduce. A single stranded phosphorothioate oligonucleotides (donor ssODN) with the following sequence (atgacgacaaaggccactgcattgaggagcaagatggataatatgtagacttgtgacagagtggattcgacatccatggggaggcagatcgatactttcgtgtaactgctgacaccgacaaggggcaatgtggccatcagggtagaaaaaatccatcctccgagcataattgggatggcatgtctcagcctcagcttttg) was used. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Leydig cell hypoplasia due to partial LH resistance / Orphanet_96266
- Leydig cell hypoplasia due to complete LH resistance / Orphanet_96265
- Familial male-limited precocious puberty / Orphanet_3000
MGI phenotypes (gene matching)
- abnormal abdominal fat pad morphology / MGI
- enlarged adrenal glands / MGI
- small prostate gland anterior lobe / MGI
- bulbourethral gland hypoplasia / MGI
- enlarged spleen / MGI
- abnormal female reproductive system morphology / MGI
- abnormal uterus morphology / MGI
- abnormal ovary morphology / MGI
- small ovary / MGI
- impaired ovarian folliculogenesis / MGI
- absent mature ovarian follicles / MGI
- absent corpus luteum / MGI
- abnormal vagina orifice morphology / MGI
- abnormal male reproductive system morphology / MGI
- small testis / MGI
- Leydig cell hyperplasia / MGI
- small seminiferous tubules / MGI
- arrest of spermatogenesis / MGI
- small seminal vesicle / MGI
- abnormal prostate gland morphology / MGI
- increased body weight / MGI
- decreased body weight / MGI
- abnormal ejaculation / MGI
- increased circulating follicle stimulating hormone level / MGI
- increased circulating luteinizing hormone level / MGI
- abnormal reproductive system physiology / MGI
- reduced male fertility / MGI
- male infertility / MGI
- female infertility / MGI
- testis hypoplasia / MGI
- abnormal seminiferous tubule morphology / MGI
- reproductive system inflammation / MGI
- cryptorchism / MGI
- abnormal sexual interaction / MGI
- abnormal epididymis morphology / MGI
- delayed vaginal opening / MGI
- abnormal caput epididymis morphology / MGI
- abnormal cauda epididymis morphology / MGI
- oligozoospermia / MGI
- decreased circulating luteinizing hormone level / MGI
- small prostate gland / MGI
- decreased circulating testosterone level / MGI
- increased circulating testosterone level / MGI
- abnormal testes secretion / MGI
- abnormal ovarian secretion / MGI
- absent Leydig cells / MGI
- decreased circulating follicle stimulating hormone level / MGI
- enlarged seminal vesicle / MGI
- early sexual maturation / MGI
- abnormal vagina development / MGI
- epididymal inflammation / MGI
- prostate gland inflammation / MGI
- scrotum hypoplasia / MGI
- increased kidney weight / MGI
- abnormal sperm physiology / MGI
- decreased testis weight / MGI
- decreased ovary weight / MGI
- increased seminal vesicle weight / MGI
- decreased seminal vesicle weight / MGI
- increased epididymis weight / MGI
- decreased epididymis weight / MGI
- small epididymis / MGI
- epididymis hypoplasia / MGI
- abnormal epididymis epithelium morphology / MGI
- enlarged prostate gland / MGI
- increased prostate gland weight / MGI
- prostate gland hypoplasia / MGI
- seminal vesicle hypoplasia / MGI
- decreased circulating estradiol level / MGI
- increased circulating estradiol level / MGI
- decreased circulating progesterone level / MGI
- small penis / MGI
- abnormal anogenital distance / MGI
- reproductive system phenotype / MGI
- Leydig cell hypoplasia / MGI
- thin myometrium / MGI
- thin endometrium / MGI
- abnormal male germ cell apoptosis / MGI
- absent estrous cycle / MGI
- absent estrus / MGI
- thin uterus / MGI
- thin uterine horn / MGI
- decreased endometrial gland number / MGI
- absent endometrial glands / MGI
- external male genitalia atrophy / MGI
- vas deferens hypoplasia / MGI
- abnormal testosterone level / MGI
- increased urine major urinary protein level / MGI
- increased adrenal gland weight / MGI
- abnormal adult Leydig cell differentiation / MGI
- decreased epididymal cell proliferation / MGI