MGI phenotypes (gene matching)
C57BL/6NCrl-Lrpprcem1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16218 |
| Citation information | RRID:IMSR_EM:16218 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Lrpprcem1Ics/Ics |
| Alternative name | Lrpprcem1.Ics/Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Lrpprcem1Ics |
| Gene/Transgene symbol | Lrpprc |
Information from provider
| Provider | Metodi Metodiev |
| Provider affiliation | Équipe "Génétique des maladies mitochondriales", Institut Imagine (INSERM) |
| Genetic information | Alanine codon 353 (GCG) in exon 9 (ENSMUSE00000138495) was changed to valine (GTG; c.1058C>T p.A353G) using CRISPR/Cas9 technology with an sgRNA (equivalent to CACTGCGTTCCAGGTTTTAT) and an ssODN template (GCAAAAAGAAACTGCCAAAGTTATCGGAGCTCTCGTCCTTGGACAGGGGTAATGCCAATAGTACTTGGAACACAGTGTCTTCTAACTTCTCAGTGGCTAAAAACAAAATGAGGTTCATTGCATCTGC). A silent mutation was introduced to generate a ScaI diagnostic restriction site. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Congenital lactic acidosis, Saguenay-Lac-Saint-Jean type / Orphanet_70472