C57BL/6NCrl-Pak3em1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16223 |
| Citation information | RRID:IMSR_EM:16223 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Pak3em1Ics/Ics |
| Alternative name | Pak3em1Ics/Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Pak3em1Ics |
| Gene/Transgene symbol | Pak3 |
Information from provider
| Provider | Jean-Vianney Barnier |
| Provider affiliation | Institut NeuroPSI - UMR9197, CNRS Université Paris-Saclay |
| Genetic information | CRISPR/Cas9 technology generated a glycine 424 to arginine amino acid change (c.1270-1271delGGAinsCGT, p.G424R) in exon 16 (ENSMUSE00000207897). A silent mutation also introduced an RsaI restriction site. A single guided RNA AGTAAACGAAGCACTATGGT was selected for the position of the putative double stand break being close to the mutation to introduce. A single stranded phosphorothioate oligonucleotides (donor ssODN) with the following sequence (ATATCAACTTTTGGACCATAAGCTTTTCGAGTTACCACTTCAGGTGCCATCCAATAGGGAGTACGCACCATAGTGCTTCGTTTACTTTGCTCAGGAGTGATTTGAGCACAGAACCCAAAATCAG) was used. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- X-linked non-syndromic intellectual disability / Orphanet_777