C57BL/6NCrl-Scn2aem1.1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16225 |
| Citation information | RRID:IMSR_EM:16225 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Scn2aem1.1Ics/Ics |
| Alternative name | Scn2aem1.1Ics/Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Scn2aem1.1Ics |
| Gene/Transgene symbol | Scn2a |
Information from provider
| Provider | Massimo Mantegazza |
| Provider affiliation | Institut de Pharmacologie Moléculaire et Cellulaire (IPMC), CNRS UMR7275, Université Côte d |
| Genetic information | Electroporation was performed using a targeting construct along with a plasmid encoding the wild-type Cas9 protein and one specific guide RNA: ACCCATTGAATCCACAGCCT (both in circular form). A loxP site was inserted into intron 20; exon 21 (ENSMUSE00000980679) was fused to the Scn2a-201 cDNA exons 22 to 27 cds and followed by a 3XpA sequence, an FRT site flanked neomycin resistance gene cassette, and a second loxP site. Downstream the second loxP site, the genomic sequence resumes with the last 291 bases of intron 20 and exon 21 in which leucine codon 1314 (CTA) was changed to proline (CCA) (C.3944T>C p.L1314P). The neo resistance cassette was removed through subsequent flp-mediated recombination leading to a conditional point mutation allele. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |