IMPC phenotypes (gene matching)
C57BL/6NCrl-Shhem1.1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:16226 |
| Citation information | RRID:IMSR_EM:16226 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NCrl-Shhem1.1Ics/Ics |
| Alternative name | Shhem1.1Ics/Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Shhem1.1Ics |
| Gene/Transgene symbol | Shh |
Information from provider
| Provider | Valerie Dupé |
| Provider affiliation | Institut de Génétique et Développement de Rennes IGDR, UMR6290 - Université de Rennes, Faculté de Médecine |
| Genetic information | Electroporation was conducted using a targeting construct along with a plasmid encoding the wild-type Cas9 protein and a specific guide RNA GACTTTAGCTATTGGAGCGC (both in circular form). The third base of codon 293 (AGC) in exon 3 (ENSMUSE00000409051) was changed into a T (c.879C>T p.S293S). A floxed NeoR-protamine cre selection cassette was inserted upstream exon 3 and auto-excised leaving a single loxP site. |
| Phenotypic information | Homozygous:N/AHeterozygous:N/A |
| Breeding history | 100% C57BL/6NCrl |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Alobar holoprosencephaly / Orphanet_93925
- Triphalangeal thumb-polysyndactyly syndrome / Orphanet_2950
- Midline interhemispheric variant of holoprosencephaly / Orphanet_93926
- Colobomatous microphthalmia / Orphanet_98938
- Polydactyly of a triphalangeal thumb / Orphanet_93336
- Syndactyly type 4 / Orphanet_93405
- Hypoplastic tibiae-postaxial polydactyly syndrome / Orphanet_3332
- Lobar holoprosencephaly / Orphanet_93924
- Autosomal dominant preaxial polydactyly-upperback hypertrichosis syndrome / Orphanet_476119
- Microform holoprosencephaly / Orphanet_280200
- Septopreoptic holoprosencephaly / Orphanet_280195
- Radial hemimelia / Orphanet_93321
- Semilobar holoprosencephaly / Orphanet_220386
- Holoprosencephaly / Orphanet_2162
- Tibial hemimelia-polysyndactyly-triphalangeal thumb syndrome / Orphanet_988
MGI phenotypes (gene matching)
- absent scala media / MGI
- absent endolymphatic duct / MGI
- abnormal neurocranium morphology / MGI
- abnormal frontal bone morphology / MGI
- abnormal vertebrae morphology / MGI
- absent vertebrae / MGI
- abnormal rib morphology / MGI
- abnormal cartilage morphology / MGI
- abnormal cartilage development / MGI
- abnormal heart morphology / MGI
- abnormal hair follicle morphology / MGI
- absent hair follicles / MGI
- abnormal hair follicle orientation / MGI
- absent hair follicle inner root sheath / MGI
- alopecia / MGI
- abnormal craniofacial morphology / MGI
- microcephaly / MGI
- abnormal cranium morphology / MGI
- absent mouth / MGI
- abnormal maxilla morphology / MGI
- abnormal digestive system morphology / MGI
- abnormal esophagus morphology / MGI
- abnormal stomach glandular epithelium morphology / MGI
- abnormal foregut morphology / MGI
- abnormal pulmonary artery morphology / MGI
- abnormal colon morphology / MGI
- abnormal small intestine morphology / MGI
- short limbs / MGI
- absent forelimb / MGI
- abnormal hindlimb morphology / MGI
- absent hindlimb / MGI
- adactyly / MGI
- polydactyly / MGI
- syndactyly / MGI
- oligodactyly / MGI
- abnormal autopod morphology / MGI
- abnormal liver development / MGI
- abnormal smooth muscle morphology / MGI
- decreased brain size / MGI
- abnormal forebrain morphology / MGI
- abnormal telencephalon morphology / MGI
- cerebellum hypoplasia / MGI
- abnormal cerebellum external granule cell layer morphology / MGI
- absent floor plate / MGI
- absent notochord / MGI
- abnormal motor neuron morphology / MGI
- decreased motor neuron number / MGI
- decreased spinal cord size / MGI
- abnormal enteric neuron morphology / MGI
- abnormal lung morphology / MGI
- abnormal lung development / MGI
- pulmonary hypoplasia / MGI
- thick epidermis / MGI
- epidermal hyperplasia / MGI
- abnormal dermal layer morphology / MGI
- decreased body weight / MGI
- anophthalmia / MGI
- microphthalmia / MGI
- abnormal vasculogenesis / MGI
- abnormal embryo development / MGI
- abnormal somite shape / MGI
- abnormal embryo size / MGI
- decreased embryo size / MGI
- abnormal dorsal-ventral axis patterning / MGI
- perinatal lethality / MGI
- abnormal eye morphology / MGI
- abnormal ear morphology / MGI
- abnormal limb morphology / MGI
- abnormal axial skeleton morphology / MGI
- abnormal limb bone morphology / MGI
- abnormal craniofacial bone morphology / MGI
- abnormal cardiovascular system morphology / MGI
- abnormal respiratory system morphology / MGI
- abnormal kidney morphology / MGI
- abnormal neural tube morphology / MGI
- no abnormal phenotype detected / MGI
- decreased brain weight / MGI
- abnormal pharynx morphology / MGI
- abnormal bronchus morphology / MGI
- abnormal tracheal smooth muscle morphology / MGI
- brachyphalangia / MGI
- brachydactyly / MGI
- small stomach / MGI
- absent tibia / MGI
- small olfactory bulb / MGI
- short tibia / MGI
- short fibula / MGI
- abnormal posterior semicircular canal morphology / MGI
- absent cartilage / MGI
- abnormal joint morphology / MGI
- no phenotypic analysis / MGI
- abnormal superior semicircular canal morphology / MGI
- abnormal tracheal cartilage morphology / MGI
- anal atresia / MGI
- absent lateral semicircular canal / MGI
- fused joints / MGI
- abnormal duodenum morphology / MGI
- abnormal digestive organ placement / MGI
- tracheoesophageal fistula / MGI
- decreased rib number / MGI
- abnormal optic vesicle formation / MGI
- nervous system phenotype / MGI
- abnormal nervous system morphology / MGI
- abnormal hair follicle development / MGI
- abnormal long bone morphology / MGI
- abnormal submandibular gland morphology / MGI
- abnormal hair shaft morphology / MGI
- abnormal forelimb zeugopod morphology / MGI
- abnormal hindlimb zeugopod morphology / MGI
- abnormal heart left atrium morphology / MGI
- embryonic growth retardation / MGI
- abnormal lung vasculature morphology / MGI
- abnormal spinal cord interneuron morphology / MGI
- abnormal prenatal growth/weight/body size / MGI
- decreased fetal size / MGI
- fetal growth retardation / MGI
- abnormal optic stalk morphology / MGI
- abnormal optic cup morphology / MGI
- abnormal embryonic/fetal subventricular zone morphology / MGI
- abnormal postnatal subventricular zone morphology / MGI
- absent vestibulocochlear ganglion / MGI
- absent vestibular saccule / MGI
- bowed tibia / MGI
- absent utricle / MGI
- bowed fibula / MGI
- abnormal respiratory conducting tube morphology / MGI
- occipital bone foramen / MGI
- absent tracheal cartilage rings / MGI
- cervical vertebral fusion / MGI
- short metacarpal bones / MGI
- notochord degeneration / MGI
- abnormal gallbladder morphology / MGI
- holoprosencephaly / MGI
- cyclopia / MGI
- gastric metaplasia / MGI
- abnormal humerus morphology / MGI
- abnormal phalanx morphology / MGI
- limbs/digits/tail phenotype / MGI
- homeostasis/metabolism phenotype / MGI
- embryo phenotype / MGI
- behavior/neurological phenotype / MGI
- absent fibula / MGI
- stomach epithelial hyperplasia / MGI
- abnormal skeleton morphology / MGI
- abnormal vascular smooth muscle morphology / MGI
- abnormal cell physiology / MGI
- abnormal otic vesicle development / MGI
- increased apoptosis / MGI
- annular pancreas / MGI
- abnormal limb development / MGI
- abnormal nasal pit morphology / MGI
- slow postnatal weight gain / MGI
- hemimelia / MGI
- absent external male genitalia / MGI
- absent external female genitalia / MGI
- abnormal cystic duct morphology / MGI
- abnormal dermis papillary layer morphology / MGI
- acephaly / MGI
- decreased keratinocyte proliferation / MGI
- abnormal atrium myocardium morphology / MGI
- absent pulmonary vein / MGI
- fusion of atlas and odontoid process / MGI
- abnormal lung saccule morphology / MGI
- impaired lung lobe morphogenesis / MGI
- abnormal branching involved in lung morphogenesis / MGI
- impaired branching involved in bronchus morphogenesis / MGI
- postnatal lethality, incomplete penetrance / MGI
- neonatal lethality, complete penetrance / MGI
- perinatal lethality, complete penetrance / MGI
- perinatal lethality, incomplete penetrance / MGI
- prenatal lethality, incomplete penetrance / MGI
- embryonic lethality during organogenesis, incomplete penetrance / MGI
- lethality throughout fetal growth and development, incomplete penetrance / MGI
- decreased somite size / MGI
- decreased midbrain size / MGI
- absent diencephalon / MGI
- decreased chondrocyte proliferation / MGI
- abnormal chondrocyte differentiation / MGI
- abnormal gallbladder size / MGI
- thin interparietal bone / MGI