MGI phenotypes (allele matching)
- no phenotypic analysis / MGI
C57BL/6N-Acox2em1Pvv/Ph
| Status | Available to order |
| EMMA ID | EM:09380 |
| Citation information | RRID:IMSR_EM:09380 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6N-Acox2em1Pvv/Ph |
| Alternative name | B6.Acox2em1 |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Acox2em1Pvv |
| Gene/Transgene symbol | Acox2 |
Information from provider
| Provider | Paul Van Veldhoven |
| Provider affiliation | KU Leuven |
| Genetic information | To knock-out the Acox2 gene TAL effector nucleases were used that led to deletion of exon 4 resulting in a frameshift. Two TALEN pairs were used, targeting beginning and end of exon 4. Targeting sequence at exon start was as follows: 5‘-CATCTACAGCGTCTCTTCCCCCACAGAGTCCTTGCTGGATATAACAACTTA AACTTAC-3‘; targeting sequence at the exon end: 5‘-CATCACAACATATGCCCAGACAGAGCTGGGACATGGTAAGCCAAAGCTG CTGCATGC-3‘. Founder mice were generated by cytoplasmatic injection of TALENs into C57BL/6N mouse zygotes. Founder mice were bred to wild-type C57BL/6N partner and offspring was analyzed by PCR and sequencing. One targeting resulted in deletion of 176bp covering the whole exon 4. |
| Phenotypic information | Homozygous:Not known, until now mice were kept on heterozygous status.Heterozygous:Heterozygous mice do not show an obvious phenotype. Mice appear normal. |
| References |
|
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Institute of Molecular Genetics, Prague, Czech Republic |
Disease and phenotype information
Literature references
- Peroxisomal metabolism of branched fatty acids regulates energy homeostasis.;Liu Xuejing, He Anyuan, Lu Dongliang, Hu Donghua, Tan Min, Abere Abenezer, Goodarzi Parniyan, Ahmad Bilal, Kleiboeker Brian, Finck Brian N, Zayed Mohamed, Funai Katsuhiko, Brestoff Jonathan R, Javaheri Ali, Weisensee Patricia, Mittendorfer Bettina, Hsu Fong-Fu, Van Veldhoven Paul P, Razani Babak, Semenkovich Clay F, Lodhi Irfan J, ;2025;Nature;646;1223-1231; 40963015