- hyperactivity / IMPC
- abnormal auditory brainstem response / IMPC
- abnormal bone structure / IMPC
- abnormal startle reflex / IMPC
- decreased bone mineral density / IMPC
- increased circulating HDL cholesterol level / IMPC
- increased heart weight / IMPC
- increased circulating alkaline phosphatase level / IMPC
- decreased bone mineral content / IMPC
- increased exploration in new environment / IMPC
B6N;FVB-Wdr45em1Wrst/Ieg
| Status | Available to order |
| EMMA ID | EM:13607 |
| Citation information | RRID:IMSR_EM:13607 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | B6N;FVB-Wdr45em1Wrst/Ieg |
| Alternative name | Wdr45 -/-; Wdr45 -/Y; Wdr45 -/+ |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Wdr45em1Wrst |
| Gene/Transgene symbol | Wdr45 |
Information from provider
| Provider | Holger Prokisch |
| Provider affiliation | HMGU |
| Additional owner | Dr. Ancangela Iuso, HMGU, Munich, Germany.
Generation of this BPAN mouse model was funded by the patient organisation 'NBIA Disorders Association', which would be interested in collaboration/exchange with any scientist obtaining this strain from EMMA. They can be contacted at info@NBIAdisorders.org. |
| Genetic information | We have introduced a 20-bp deletion in exon 2 of the mouse Wdr45 gene using the TALENs technique. This deletion causes a frameshift and is predicted to introduce a premature stop codon 35 amino acids after the initial methionine. Pathogenic variants in the human WDR45 gene on chromosome Xp11 are the genetic cause of a rare neurological disorder characterized by increased iron deposition in the basal ganglia. As WDR45 encodes a beta-propeller scaffold protein with a putative role in autophagy, the disease has been named Beta-Propeller Protein-Associated Neurodegeneration (BPAN). BPAN represents one of the four most common forms of Neurodegeneration with Brain Iron Accumulation (NBIA). |
| Phenotypic information | Homozygous:Homozygous: Increased slips and falls, increased traversing times, increased tremor and limb grasping, no ABR response, reduced response to click, retinal degeneration, reduced retinal and cornea thickness, increment of the axial length, deeper anterior chamber, increased plasma creatinine, glucose, ASAT, LDH, ALP, and decreased plasma lactate, slightly increased plasma iron concentration and increased transferrin saturation, elevated RDW.Heterozygous:Hemizygous: Increased slips and falls, increased traversing times, increased locomotor activity and speed, impaired social recognition memory,increased tremor and limb grasping, no ABR response, reduced response to click,retinal degeneration, reduced retinal and cornea thickness, increment of the axial length, deeper anterior chamber,increment of the axial length, deeper anterior chamber, increased plasma creatinine, glucose, ASAT, LDH, ALP, and decreased plasma lactate, slightly increased plasma iron concentration and increased transferrin saturation, elevated RDW, decreased TP, albumin, TIBC in all KO and decreased alpha-amylase activity and triglycerides levels,slightly increased plasma iron concentration and increased transferrin saturation, elevated RDW, elevated WBC, RBC, HGB HCT. Spheroids and swollen structures (degenerated neurons) in basal ganglia, thalamus, cerebral cortex, medulla oblongata, ascending and descending fibres of the spinal cord and deep cerebellar nuclei. Progressive eosinophilic spheroids between 4-18 months. Ubiquitin: accumulation of aggregates in the medulla oblongata. GFAP: accumulation of aggregates in the medulla oblongata. CALB: impaired Purkinje cell layer of the cerebellar cortex. Dopamine: reduced number of neuroaxonal fibres in the substantia nigra. |
| Breeding history | Wdr45 knock-out mice were generated using the Transcription Activator-Like Effector Nucleases (TALEN) approach according to the established protocols (Boch et al. 2009; Zhang et al. 2011). The system was designed to introduce mutations in exon 2 of Wdr45 (NM_001290792.1, GRCm38.p6). Oligonucleotides were codon-optimized for murine usage (GenScript, New Jersey, USA). Before microinjection, TALEN efficiency was tested in vitro using reporter assays (Gal reporter gene assay, Roche Applied Science, Germany; High-sensitivity luciferase reporter gene assay, Roche Applied Science, Germany). Females of the inbred strain FVB were mated with C57BL/6N males. The resulting fertilized oocytes were collected, and TALENs were injected into the larger male pronucleus. Injected embryos were implanted into pseudopregnant CD-1 foster mothers, giving birth to animals with FVB and C57BL/6N mixed background. Sanger sequencing using the following primers Forward: CTTCAGAGAGGACACTGGGG and Reverse: TCAGGGTATACGTGGGAAGG identified a 20-bp deletion in mutant animals. The deletion is predicted to cause termination of the protein after 35 amino acids from the initial methionine. Animals from F0, mosaic for the 20-bp deletion in Wdr45, were bred to F1 generation to obtain uniform germline transmission of the mutation. Inbreeding of heterozygous females (Wdr45-/+) with a hemizygous male (Wdr45-/Y) from the F1 generation resulted in hemizygous (Wdr45-/Y, Wdr45+/Y), heterozygous (Wdr45-/+), and homozygous (Wdr45-/-) Wdr45 knock-out mice in the F2. By inbreeding F2 animals, we generated two larger Wdr45 knock-out cohorts used for in-depth analysis and progression analysis, respectively. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Helmholtz Zentrum Muenchen - German Research Center for Environmental Health (GmbH), Oberschleißheim, Germany |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Beta-propeller protein-associated neurodegeneration / Orphanet_329284
- Infantile spasms syndrome / Orphanet_3451
IMPC phenotypes (gene matching)
Literature references
- A comprehensive phenotypic characterization of a whole-body Wdr45 knock-out mouse.;Biagosch Caroline A, Vidali Silvia, Faerberboeck Michael, Hensler Svenja-Viola, Becker Lore, Amarie Oana V, Aguilar-Pimentel Antonio, Garrett Lillian, Klein-Rodewald Tanja, Rathkolb Birgit, Zanuttigh Enrica, Calzada-Wack Julia, da Silva-Buttkus Patricia, Rozman Jan, Treise Irina, Fuchs Helmut, Gailus-Durner Valerie, de Angelis Martin Hrabě, Janik Dirk, Wurst Wolfgang, Mayr Johannes A, Klopstock Thomas, Meitinger Thomas, Prokisch Holger, Iuso Arcangela, ;2021;Mammalian genome : official journal of the International Mammalian Genome Society;32;332-349; 34043061
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).
