C57BL/6J-Gnao1em2Katv/Cnrm
| Status | Under development - register interest |
| EMMA ID | EM:14988 |
| International strain name | C57BL/6J-Gnao1em2Katv/Cnrm |
| Alternative name | B6.Gnao1 C215Y/Ugfm |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Gnao1em2Katv, |
| Gene/Transgene symbol | Gnao1 |
Information from provider
| Provider | Fabrizio Thorel |
| Provider affiliation | Transgenesis facility, University of Geneva |
| Genetic information | Mutation: Gnao1 c.644G>A CRISPR/Cas9 gRNA: CCGTGACATCCTCAAAGCAG ssDNA:GGCCAGCGATCTGAACGCAAGAAGTGGATCCACTACTTTGAGGA TGTCACGGCCATCATCTTCTGTGTCGCACTCAGCGGCTATGACCAGG CRISPR technology details: Recombinant HiFi Cas9 Nuclease (cat. # 1081060 from IDT) mixed with nucleotides was directly injected in the embryos. |
| Phenotypic information | Homozygous:The animals were found to exert no epilepsy-like behavior (no spontaneous seizures, visible movement difficulties were observed) or other abnormalities in housing conditions in either homozygous or heterozygous state. In certain behavioral experiments demonstrate weak-to-mild phenotypes of hyperkinesia. All the details can be found in associated publication (DOI: 10.1186/s40478-022-01312-z)Heterozygous:Certain mild differences were identified between homo- and heterozygous animals indicating certain aggravation of the phenotype in homozygous state. However, in the normal housing conditions homozygous animals are largely normal and good breeders. |
| Breeding history | Generation of the mutant was performed on pure C57BL/6 background. F0 generation consisted of 1 heterozygous (male) and 5 homozygous (4 males, 1 female) animals. One homozygous male was chosen based on the best breeding performance and his sperm was the one deposited. At the time of the deposit we had produced F4 generation including both hetero- and homozygous animals. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | CNR, Consiglio Nazionale delle Ricerche, Monterotondo, Italy |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- Early infantile epileptic encephalopathy / Orphanet_1934
- GNAO1-related developmental delay-seizures-movement disorder spectrum / Orphanet_592564
Literature references
- Mouse models characterize GNAO1 encephalopathy as a neurodevelopmental disorder leading to motor anomalies: from a severe G203R to a milder C215Y mutation.;Silachev Denis, Koval Alexey, Savitsky Mikhail, Padmasola Guru, Quairiaux Charles, Thorel Fabrizio, Katanaev Vladimir L, ;2022;Acta neuropathologica communications;10;9; 35090564