Sprague Dawley rat Clcn4em1Ics

Status

Available to order

EMMA IDEM:15193
Citation informationEM:15193 
International strain nameSprague Dawley rat Clcn4em1Ics
Alternative nameSprague Dawley rat Clcn4em1Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolrat Clcn4em1Ics
Gene/Transgene symbolrat Clcn4

Information from provider

Provider Cure CLCN4
Provider affiliationCure CLCN4
Genetic informationThe Clcn4 KO rat model was generated using a 2 pairs of guide RNA CRISPR/Cas9 approach to deleted exon 4 (ENSRNOE00000033426.1), a critical exon. The deletion of exon 4 leads to a frame shift and a premature STOP codon The sequences of the four guide RNAs are the following: TGCTGCATGAATAACGTGAC and GCTGCATGAATAACGTGACT (5' guide RNA pair) and TCATAAACCTATGCAGCGTG and CTGTCATCCACACGCTGCAT (3' guide RNAs pair). Both 4 guides were electroporated as RNPs (crRNA/tracRNA and Cas9 protein). Putative founders and F1 pups were characterized by PCR using the following primer: GGGATACTTTTGCTGATGAGTAGAGGAG and CCAAAGAACACTGGAGGGACCTATC.
Phenotypic informationHomozygous:
Not done

Heterozygous:
No phenotype observed
Breeding historyThe line was kept in a Sprague Dawley (Janvier Labs; RjHan:SD strain) genetic background.
ReferencesNone available
Homozygous fertilenot known
Homozygous viablenot known
Homozygous matings requiredno
Immunocompromisednot known

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen embryos. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Other EMMA strains

Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).