Sprague Dawley rat Clcn4em1Ics
| Status | Available to order |
| EMMA ID | EM:15193 |
| International strain name | Sprague Dawley rat Clcn4em1Ics |
| Alternative name | Sprague Dawley rat Clcn4em1Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Clcn4em1Ics |
| Gene/Transgene symbol | Clcn4 |
Information from provider
| Provider | Cure CLCN4 |
| Provider affiliation | Cure CLCN4 |
| Genetic information | The Clcn4 KO rat model was generated using a 2 pairs of guide RNA CRISPR/Cas9 approach to deleted exon 4 (ENSRNOE00000033426.1), a critical exon. The deletion of exon 4 leads to a frame shift and a premature STOP codon The sequences of the four guide RNAs are the following: TGCTGCATGAATAACGTGAC and GCTGCATGAATAACGTGACT (5' guide RNA pair) and TCATAAACCTATGCAGCGTG and CTGTCATCCACACGCTGCAT (3' guide RNAs pair). Both 4 guides were electroporated as RNPs (crRNA/tracRNA and Cas9 protein). Putative founders and F1 pups were characterized by PCR using the following primer: GGGATACTTTTGCTGATGAGTAGAGGAG and CCAAAGAACACTGGAGGGACCTATC. |
| Phenotypic information | Homozygous:Not doneHeterozygous:No phenotype observed |
| Breeding history | The line was kept in a Sprague Dawley genetic background |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |