rat SD-Clcn4em2Ics/Ics
| Status | Available to order |
| EMMA ID | EM:15194 |
| Citation information | EM:15194 |
| International strain name | rat SD-Clcn4em2Ics/Ics |
| Alternative name | Sprague Dawley rat Clcn4em2(A549V)Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | rat Clcn4em2(A549V)Ics |
| Gene/Transgene symbol | rat Clcn4 |
Information from provider
| Provider | Cure CLCN4 |
| Provider affiliation | Cure CLCN4 |
| Genetic information | The A549V mutation (GCT>GTT; corresponding to the human A555V mutation) was introduced in rat Clcn4 gene using a CRISPR/Cas9 approach. The ribonucleoprotein complex composed by a guide TGGTAACAGCAGCTGCCATC and the Cas9 protein was co-electroporated with a single stranded donor DNA (gtgtctctggtagtcatcatgtttgaactgactggaggtctggaatatattgtaccgctcatggcagttgctgttaccagcaagtgggtggctgatgcctttgggaaagaagggatttatgaagc) bearing the A549V mutation and 2 additional silent mutations, one of them mutating the PAM sequence and both leading to a new BsrBI diagnostic restriction site. Pups were genotyped with the following primers: gggataaaattatgatctgtaagct and gagtctccacatcctccacagtcat. In the presence of the mutation, this 390 bps PCR fragment will be digested in 2 fragments of 170 and 220 bps by BsrBI |
| Phenotypic information | Homozygous:Not doneHeterozygous:Smaller animals, especially hemizygous males. Dental malocclusion and locomotor problem found in a male |
| Breeding history | The line was kept on a Sprague-Dawley (Janvier Labs; RjHan:SD strain) genetic background. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).
