Sprague Dawley rat Mifem1Ics
Status | Available to order |
EMMA ID | EM:15567 |
International strain name | Sprague Dawley rat Mifem1Ics |
Alternative name | Sprague Dawley rat Mif |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Mif-KO |
Gene/Transgene symbol | Mif |
Information from provider
Provider | Marie-Christine Birling |
Provider affiliation | Genetic Engineering , PHENOMIN-ICS |
Genetic information | This Mif knock-out rat line was obtained by microinjection of Cas9 mRNA and 2 pairs of guide RNAs - actacctagcttattaaatg (gR76), gcatcctccgtttctatctt (gR79), tccaggctgggaacgtgcga (gR94) and cccatcgcacgttcccagcc (gR94) - in Sprague Dawley embryos. It resulted in the deletion of whole gene sequence (spanning over 1027 bps) of rat Mif. This deletion leads to the knock-out of Mif. |
Phenotypic information | Homozygous:homozygous animal are viableHeterozygous:no phenotype observed |
Breeding history | The line was kept in a Sprague Dawley background. |
References | None available |
Homozygous fertile | not known |
Homozygous viable | yes |
Homozygous matings required | no |
Immunocompromised | no |
Information from EMMA
Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).