C57BL/6N-Dyrk1aem1(IMPC)Ics/Ics

Status

Available to order

EMMA IDEM:15793
Citation informationRRID:IMSR_EM:15793 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

 
International strain nameC57BL/6N-Dyrk1aem1(IMPC)Ics/Ics
Alternative nameDyrk1em1(IMPC)Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolDyrk1aem1(IMPC)Ics
Gene/Transgene symbolDyrk1a

Information from provider

Provider ICS, Institut Clinique de la Souris
Provider affiliationICS, Institut Clinique de la Souris
Genetic informationThis allele was generated at the Institute Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CAAGCAGCCGCACTTCTATC) /tracRNA and a single stranded donor DNA, which resulted in the p.A195T mutation in exon 6 of the Dyrk1a gene (ENSMUSE00000131727; GRCm39). A XmnI diagnostic restriction site was associated with the mutation to facilitate genotyping. This line is cryopreserved
Phenotypic informationHomozygous:
NA

Heterozygous:
Viable, no obvious phenotype
Breeding historyThis line was generated on a pure C57BL/6N genetic background.
ReferencesNone available
Homozygous fertilenot known
Homozygous viablenot known
Homozygous matings requirednot known
Immunocompromisednot known

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).