C57BL/6N-Dyrk1aem1(IMPC)Ics/Ics
| Status | Available to order |
| EMMA ID | EM:15793 |
| Citation information | RRID:IMSR_EM:15793 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6N-Dyrk1aem1(IMPC)Ics/Ics |
| Alternative name | Dyrk1em1(IMPC)Ics |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Dyrk1aem1(IMPC)Ics |
| Gene/Transgene symbol | Dyrk1a |
Information from provider
| Provider | ICS, Institut Clinique de la Souris |
| Provider affiliation | ICS, Institut Clinique de la Souris |
| Genetic information | This allele was generated at the Institute Clinique de la Souris by co-electroporating Cas9 protein, a crRNA (CAAGCAGCCGCACTTCTATC) /tracRNA and a single stranded donor DNA, which resulted in the p.A195T mutation in exon 6 of the Dyrk1a gene (ENSMUSE00000131727; GRCm39). A XmnI diagnostic restriction site was associated with the mutation to facilitate genotyping. This line is cryopreserved |
| Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
| Breeding history | This line was generated on a pure C57BL/6N genetic background. |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | not known |
| Immunocompromised | not known |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).
