C57BL/6N-Prune1em1(IMPC)Ics/Ics
Status | Available to order |
EMMA ID | EM:15795 |
Citation information | RRID:IMSR_EM:15795 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
International strain name | C57BL/6N-Prune1em1(IMPC)Ics/Ics |
Alternative name | Prune1em1(IMPC)ICS |
Strain type | Endonuclease-mediated |
Allele/Transgene symbol | Prune1em1(IMPC)Ics |
Gene/Transgene symbol | Prune1 |
Information from provider
Provider | ICS, Institut Clinique de la Souris |
Provider affiliation | ICS, Institut Clinique de la Souris |
Genetic information | This allele was generated at the Institute Clinique de la Souris by microinjecting a mix of Cas9 RNA, an RNA guide (CTTACTTGGGTAAAATATGG) and a single stranded donor DNA, which resulted in the p.D106N mutation of Prune1 in exon 3 (ENSMUSE00000253496; GRCm39). A DdeI diagnostic restriction site is associated to the mutation to facilitate genotyping. This line is cryopreserved. Note: The mouse strains EM:13030 and EM:15795 carry the same point mutation, D106N. They were created independently by the Mary Lyon Centre at MRC Harwell and Institut Clinique de la Souris, respectively. The two strains differ in their backgrounds; EM:13030 carries the allele on a C57BL/6NTac background whereas EM:15795 carries the allele on a C57BL/6NCrl background. |
Phenotypic information | Homozygous:NAHeterozygous:Viable, no obvious phenotype |
Breeding history | This line was generated on a pure C57BL/6N genetic background. |
References | None available |
Homozygous fertile | not known |
Homozygous viable | not known |
Homozygous matings required | not known |
Immunocompromised | not known |
Information from EMMA
Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
Orphanet associated rare diseases, based on orthologous gene matching
- PRUNE1-related neurological syndrome / Orphanet_544469
IMPC phenotypes (gene matching)
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).