- enlarged spleen / IMPC
- increased mean corpuscular volume / IMPC
- hyperplasia / IMPC
- abnormal uterus morphology / IMPC
- abnormal skin morphology / IMPC
- small heart / IMPC
- enlarged lymph nodes / IMPC
- abnormal lymph node morphology / IMPC
- abnormal heart morphology / IMPC
- abnormal spleen morphology / IMPC
- abnormal liver morphology / IMPC
- increased circulating bilirubin level / IMPC
- enlarged heart / IMPC
- abnormal brain morphology / IMPC
- histiocytic sarcoma / IMPC
- abnormal kidney morphology / IMPC
- enlarged kidney / IMPC
- increased freezing behavior / IMPC
- lymphoid hyperplasia / IMPC
- small kidney / IMPC
C57BL/6N-Crlf2em1.1Ics/Ics
| Status | Available to order |
| EMMA ID | EM:15889 |
| Citation information | RRID:IMSR_EM:15889 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6N-Crlf2em1.1Ics/Ics |
| Alternative name | K515b |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Crlf2em1.1Ics |
| Gene/Transgene symbol | Crlf2 |
Information from provider
| Provider | Mei Li |
| Provider affiliation | Institut de Génétique et de Biologie Moléculaire et Cellulaire, Université de Strasbourg |
| Genetic information | A loxP site was inserted upstream of exon 3 (ENSMUSE00000448099; Crlf2-201). An FRT-flanked Neo cassette followed by a 3' loxP site was inserted downstream of exon 3. The neo cassette was removed by flp-mediated recombination using our FlpO deleter mouse line (MGI:5285396) and left exon 3 floxed. The ES cell targeting was assisted by CRISPR/Cas9 (co-electroporation of the circular targeting construct with a circular CRISPR plasmid expressing the wild-type SpCas9 and the TTTTAAACGCCTGAAAGAGT guide RNA in the proprietary C57BL/6NCrl S3 cell line). For additional information, please have a look at this report. |
| Phenotypic information | Homozygous:N/AHeterozygous:No phenotype observed |
| Breeding history | Pure C57BL/6N genetic background. |
| References |
|
| Homozygous fertile | not known |
| Homozygous viable | not known |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | ICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France |
Disease and phenotype information
IMPC phenotypes (gene matching)
Literature references
- Keratinocyte-derived cytokine TSLP promotes growth and metastasis of melanoma by regulating the tumor-associated immune microenvironment.;Yao Wenjin, German Beatriz, Chraa Dounia, Braud Antoine, Hugel Cecile, Meyer Pierre, Davidson Guillaume, Laurette Patrick, Mengus Gabrielle, Flatter Eric, Marschall Pierre, Segaud Justine, Guivarch Marine, Hener Pierre, Birling Marie-Christine, Lipsker Dan, Davidson Irwin, Li Mei, ;2022;JCI insight;7;; 36107619
Information on how we integrate external resources can be found here
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).
