C57BL/6N-Crlf2em1.1Ics/Ics

Status

Available to order

EMMA IDEM:15889
Citation informationRRID:IMSR_EM:15889 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

International strain nameC57BL/6N-Crlf2em1.1Ics/Ics
Alternative nameK515b
Strain typeEndonuclease-mediated
Allele/Transgene symbolCrlf2em1.1Ics
Gene/Transgene symbolCrlf2

Information from provider

ProviderMei Li
Provider affiliationInstitut de Génétique et de Biologie Moléculaire et Cellulaire, Université de Strasbourg
Genetic informationA loxP site was inserted upstream of exon 3 (ENSMUSE00000448099; Crlf2-201). An FRT-flanked Neo cassette followed by a 3' loxP site was inserted downstream of exon 3. The neo cassette was removed by flp-mediated recombination using our FlpO deleter mouse line (MGI:5285396) and left exon 3 floxed. The ES cell targeting was assisted by CRISPR/Cas9 (co-electroporation of the circular targeting construct with a circular CRISPR plasmid expressing the wild-type SpCas9 and the TTTTAAACGCCTGAAAGAGT guide RNA in the proprietary C57BL/6NCrl S3 cell line). For additional information, please have a look at this report.
Phenotypic informationHomozygous:
N/A

Heterozygous:
No phenotype observed
Breeding historyPure C57BL/6N genetic background.
References
  • Keratinocyte-derived cytokine TSLP promotes growth and metastasis of melanoma by regulating the tumor-associated immune microenvironment.;Yao Wenjin, German Beatriz, Chraa Dounia, Braud Antoine, Hugel Cecile, Meyer Pierre, Davidson Guillaume, Laurette Patrick, Mengus Gabrielle, Flatter Eric, Marschall Pierre, Segaud Justine, Guivarch Marine, Hener Pierre, Birling Marie-Christine, Lipsker Dan, Davidson Irwin, Li Mei, ;2022;JCI insight;7;; 36107619
Homozygous fertilenot known
Homozygous viablenot known
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

IMPC phenotypes (gene matching)
  • enlarged spleen / IMPC
  • increased mean corpuscular volume / IMPC
  • hyperplasia / IMPC
  • abnormal uterus morphology / IMPC
  • abnormal skin morphology / IMPC
  • small heart / IMPC
  • enlarged lymph nodes / IMPC
  • abnormal lymph node morphology / IMPC
  • abnormal heart morphology / IMPC
  • abnormal spleen morphology / IMPC
  • abnormal liver morphology / IMPC
  • increased circulating bilirubin level / IMPC
  • enlarged heart / IMPC
  • abnormal brain morphology / IMPC
  • histiocytic sarcoma / IMPC
  • abnormal kidney morphology / IMPC
  • enlarged kidney / IMPC
  • increased freezing behavior / IMPC
  • lymphoid hyperplasia / IMPC
  • small kidney / IMPC

Literature references

  • Keratinocyte-derived cytokine TSLP promotes growth and metastasis of melanoma by regulating the tumor-associated immune microenvironment.;Yao Wenjin, German Beatriz, Chraa Dounia, Braud Antoine, Hugel Cecile, Meyer Pierre, Davidson Guillaume, Laurette Patrick, Mengus Gabrielle, Flatter Eric, Marschall Pierre, Segaud Justine, Guivarch Marine, Hener Pierre, Birling Marie-Christine, Lipsker Dan, Davidson Irwin, Li Mei, ;2022;JCI insight;7;; 36107619

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).