C57BL/6J-Rpl3lem1Nove/Cnbc
| Status | Available to order |
| EMMA ID | EM:15996 |
| Citation information | RRID:IMSR_EM:15996 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6J-Rpl3lem1Nove/Cnbc |
| Alternative name | Rpl3l_KO |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Rpl3lem1Nove |
| Gene/Transgene symbol | Rpl3l |
Information from provider
| Provider | Eva Novoa |
| Provider affiliation | CRG |
| Genetic information | C57BL/6J genetic background. A 13 bp deletion was introduced into the 5th exon of the Rpl3l gene using CRISPR. CRISPR methodology: 50 zygotes were electroporated with a solution containing the specific sgRNA (300 ng/μl) and Cas9 mRNA (600 ng/μl). Potential sgRNAs were aligned against the mouse genome, and the Rpl3l-targeting sequence with the highest specificity score was selected (sequence: GTGGGCCTTCTTCTGCCGAAAGG; protospacer-associated motif - PAM: AGG). The Cas9-encoding gene was not integrated into the mouse genome. |
| Phenotypic information | Homozygous:The knock-out mice show no major phenotype, although aged animals display a slight reduction in total muscle mass.Heterozygous:No phenotype. |
| Breeding history | Homozygous mice were established by backcrossing to C57BL/6J. |
| References |
|
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | CNB-CSIC, Centro Nacional de Biotecnologia, Madrid, Spain |
| Animals used for archiving | homozygous C57BL/6J males |
Literature references
- Dynamic interplay between RPL3- and RPL3L-containing ribosomes modulates mitochondrial activity in the mammalian heart.;Milenkovic Ivan, Santos Vieira Helaine Graziele, Lucas Morghan C, Ruiz-Orera Jorge, Patone Giannino, Kesteven Scott, Wu Jianxin, Feneley Michael, Espadas Guadalupe, Sabidó Eduard, Hübner Norbert, van Heesch Sebastiaan, Völkers Mirko, Novoa Eva Maria, ;2023;Nucleic acids research;51;5301-5324; 36882085