IMPC phenotypes (gene matching)
- preweaning lethality, complete penetrance / IMPC
C57BL/6NTac-Gtf3c1em1H/H
| Status | Available to order |
| EMMA ID | EM:16092 |
| Citation information | RRID:IMSR_EM:16092 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6NTac-Gtf3c1em1H/H |
| Alternative name | C57BL/6NTac-Gtf3c1 |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Gtf3c1em1H |
| Gene/Transgene symbol | Gtf3c1 |
Information from provider
| Provider | Mary Lyon Centre at MRC Harwell |
| Provider affiliation | Mary Lyon Centre at MRC Harwell |
| Genetic information | This strain carries a point mutation (R1211W) in the gene Gtf3c1 introduced by electroporation of CRISPR/Cas9 regaents, SgRNAs protospacer sequence TCTTCAGCCGCTTCCGCTTC and PAM sequence TGG, and an ssODN donor oligo. |
| Phenotypic information | Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. |
| Breeding history | Coisogenic on C57BL/6NTac |
| References | None available |
| Homozygous fertile | not known |
| Homozygous viable | no |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom |