C57BL/6NTac-Gtf3c1em1H/H

Status

Available to order

EMMA IDEM:16092
Citation informationRRID:IMSR_EM:16092 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

International strain nameC57BL/6NTac-Gtf3c1em1H/H
Alternative nameC57BL/6NTac-Gtf3c1/H
Strain typeEndonuclease-mediated
Allele/Transgene symbolGtf3c1em1H
Gene/Transgene symbolGtf3c1

Information from provider

Provider Mary Lyon Centre at MRC Harwell
Provider affiliationMary Lyon Centre at MRC Harwell
Genetic informationThis strain carries a point mutation (R1211W) in the gene Gtf3c1 introduced by electroporation of CRISPR/Cas9 regaents, SgRNAs protospacer sequence TCTTCAGCCGCTTCCGCTTC and PAM sequence TGG, and an ssODN donor oligo.
Phenotypic informationMice homozygous for a transgenic gene disruption may exhibit preimplantation lethality.
Breeding historyCoisogenic on C57BL/6NTac
ReferencesNone available
Homozygous fertilenot known
Homozygous viableno
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreMary Lyon Centre at MRC Harwell, Oxford, United Kingdom

Disease and phenotype information

IMPC phenotypes (gene matching)
  • preweaning lethality, complete penetrance / IMPC

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
MTA will be issued after an order has been submitted.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).