C57BL/6J-Chrneem1H/H

Status

Available to order

EMMA IDEM:16095
Citation informationRRID:IMSR_EM:16095 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

International strain nameC57BL/6J-Chrneem1H/H
Alternative nameC57BL/6J-Chrne/H
Strain typeEndonuclease-mediated
Allele/Transgene symbolChrneem1H
Gene/Transgene symbolChrne

Information from provider

Provider Mary Lyon Centre at MRC Harwell
Provider affiliationMary Lyon Centre at MRC Harwell
Genetic informationPoint mutation (P141L) made by electroporation of CRISPR/Cas9 reagents, sgRNAs protospacer sequence AGGTGCTGCGGTAGATGGCT and PAM sequnce GGG, and an ssODN donor sequence.
Phenotypic informationHomozygous:
No data available

Heterozygous:
No data available
Breeding historyCoisogenic on C57BL/6NTac
ReferencesNone available
Homozygous fertileyes
Homozygous viableyes
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreMary Lyon Centre at MRC Harwell, Oxford, United Kingdom

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
MTA will be issued after an order has been submitted.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).