C57BL/6J-Chrneem1H/H
| Status | Available to order |
| EMMA ID | EM:16095 |
| Citation information | RRID:IMSR_EM:16095 Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information. |
| International strain name | C57BL/6J-Chrneem1H/H |
| Alternative name | C57BL/6J-Chrne |
| Strain type | Endonuclease-mediated |
| Allele/Transgene symbol | Chrneem1H |
| Gene/Transgene symbol | Chrne |
Information from provider
| Provider | Mary Lyon Centre at MRC Harwell |
| Provider affiliation | Mary Lyon Centre at MRC Harwell |
| Genetic information | Point mutation (P141L) made by electroporation of CRISPR/Cas9 reagents, sgRNAs protospacer sequence AGGTGCTGCGGTAGATGGCT and PAM sequnce GGG, and an ssODN donor sequence. |
| Phenotypic information | Homozygous:No data availableHeterozygous:No data available |
| Breeding history | Coisogenic on C57BL/6NTac |
| References | None available |
| Homozygous fertile | yes |
| Homozygous viable | yes |
| Homozygous matings required | no |
| Immunocompromised | no |
Information from EMMA
| Archiving centre | Mary Lyon Centre at MRC Harwell, Oxford, United Kingdom |