C57BL/6J-Mc2rem1H/H

Status

Available to order

EMMA IDEM:16097
Citation informationRRID:IMSR_EM:16097 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

 
International strain nameC57BL/6J-Mc2rem1H/H
Alternative nameC57BL/6J-Mc2r/H
Strain typeEndonuclease-mediated
Allele/Transgene symbolMc2rem1H
Gene/Transgene symbolMc2r

Information from provider

Provider Mary Lyon Centre at MRC Harwell
Provider affiliationMary Lyon Centre at MRC Harwell
Genetic informationThis strain carries a point mutation (F278C) introduced by electroporation of CRISPR/Cas9 reagents, sgRNAs protospacer sequence GCTCCGAAAGGCATATATAA and PAM sequence, and an ssODN donor sequence.
Phenotypic informationHomozygous:
no data available

Heterozygous:
no data available
Breeding historyCoisogenic on C57Bl/6J
ReferencesNone available
Homozygous fertileyes
Homozygous viableyes
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreMary Lyon Centre at MRC Harwell, Oxford, United Kingdom

Disease and phenotype information

Orphanet associated rare diseases, based on orthologous gene matching

MGI phenotypes (gene matching)
  • hypoglycemia / MGI
  • adrenal gland hypoplasia / MGI
  • increased anxiety-related response / MGI
  • hyperactivity / MGI
  • increased circulating adrenocorticotropin level / MGI
  • abnormal glucose homeostasis / MGI
  • decreased circulating corticosterone level / MGI
  • decreased circulating aldosterone level / MGI
  • increased susceptibility to pharmacologically induced seizures / MGI
  • increased circulating chloride level / MGI
  • abnormal gluconeogenesis / MGI
  • increased spleen weight / MGI
  • increased thymus weight / MGI
  • lethargy / MGI
  • decreased heart rate / MGI
  • decreased percent body fat/body weight / MGI
  • increased circulating potassium level / MGI
  • decreased circulating adrenaline level / MGI
  • abnormal adrenal gland zona fasciculata morphology / MGI
  • adrenal cortical hyperplasia / MGI
  • decreased brown fat lipid droplet number / MGI
  • decreased total body fat amount / MGI
  • postnatal lethality, incomplete penetrance / MGI
  • abnormal adrenal gland capsule morphology / MGI

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
MTA will be issued after an order has been submitted.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).