C57BL/6NCrl-Orc1em1Ics/Ics

Status

Available to order

EMMA IDEM:16195
Citation informationRRID:IMSR_EM:16195 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

 
International strain nameC57BL/6NCrl-Orc1em1Ics/Ics
Alternative nameOrc1em1Ics/Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolOrc1em1Ics
Gene/Transgene symbolOrc1

Information from provider

ProviderBenoit Miotto
Provider affiliation
Genetic informationThe arginine codon 104 (CGC) in exon 4 (ENSMUSE00001307667) was changed to glutamine (CAG; c.311_312delGCinsAG p.R104Q) using CRISPR/Cas9 technology with an sgRNA (equivalent to AGGCCGCAGTCCTCCTGCAC) and an ssODN template (CAATGATGGTCTCCACATTAATCTTGTTATCCCAGTCAGAACAGTCATACCAGAATATCTCCTGTGCCGGCGGACTCTGGCCTAACAAGTGCCTTTTAGAGACAGGAATCTCAAGGAATCTGACAAACC).
Phenotypic informationHomozygous:
N/A

Heterozygous:
N/A
Breeding historyC57BL/6NCrl 100%
ReferencesNone available
Homozygous fertilenot known
Homozygous viableyes
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

Orphanet associated rare diseases, based on orthologous gene matching

IMPC phenotypes (gene matching)
  • preweaning lethality, complete penetrance / IMPC
  • embryonic lethality prior to organogenesis / IMPC
  • increased lean body mass / IMPC
  • increased bone mineral content / IMPC
  • increased grip strength / IMPC
  • prenatal lethality prior to heart atrial septation / IMPC
  • increased bone mineral density / IMPC
  • decreased total body fat amount / IMPC

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).