C57BL/6N-Fat1em1.1Ics/Ics

Status

Available to order

EMMA IDEM:16212
Citation informationRRID:IMSR_EM:16212 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

 
International strain nameC57BL/6N-Fat1em1.1Ics/Ics
Alternative nameFat1em1.1Ics/Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolFat1em1.1Ics
Gene/Transgene symbolFat1

Information from provider

ProviderJulie Dumonceaux
Provider affiliationDevelopmental Neurosciences, UCL Great Ormond Street Institute of Child Health
Genetic informationElectroporation was performed using a targeting construct along with a plasmid encoding the wild-type Cas9 protein and two specific guides RNA: CTTACCGTGATGGTGACATA and AAATAACATGATCCATGACC (both in circular form). A Rox site was inserted upstream exon 3 (ENSMUSE00001335861, Fat1-202, GRCm39) and a second Rox site followed by an F3 flanked hygromycin gene resistance cassette were inserted downstream exon 3. A loxP site was inserted upstream exon 28 (ENSMUSE00001320973, Fat1-206 GRCm39) and a second loxP followed by an FRT flanked neomycin resistance gene cassette were inserted downstream exon 26. Subsequent flp-mediated recombination removed both selections cassette and led to a double conditional-ready allele. Subsequent cre or dre mediated recombination will allow, as desired, the generation of knock-out alleles for the Fat1-206 or the Fat1-203 isoform.
Phenotypic informationHomozygous:
N/A

Heterozygous:
N/A
Breeding history100% C57BL/6N (C57BL/6NCrl 99,61% C57BL/6NTac 0,39%)
ReferencesNone available
Homozygous fertilenot known
Homozygous viablenot known
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).