C57BL/6NCrl-Lhcgrem1Ics/Ics

Status

Available to order

EMMA IDEM:16216
Citation informationRRID:IMSR_EM:16216 

Research Resource Identifiers (RRID) are persistent unique ID numbers assigned to help researchers cite key resources (e.g. antibodies, model organisms and software projects) in the biomedical literature to improve transparency and reproducibility in research. See https://www.rrids.org/ for more information.

 
International strain nameC57BL/6NCrl-Lhcgrem1Ics/Ics
Alternative nameLhcgrem1Ics/Ics
Strain typeEndonuclease-mediated
Allele/Transgene symbolLhcgrem1Ics
Gene/Transgene symbolLhcgr

Information from provider

ProviderJacques Young
Provider affiliationService d’Endocrinologie, Hôpital Bicêtre
Genetic informationCRISPR/Cas9 technology generated a methionine 509 to threonine amino acid change (c.1538T>C, p.M513T) in exon 11 (ENSMUSE00000408834). A silent mutation also introduced a ClaI restriction site. Two guided RNA CATCTGCCTCCCCATGGATG and GATGGCCACATTGCCCCTTG were selected for the position of the putative double stand break being close to the mutation to introduce. A single stranded phosphorothioate oligonucleotides (donor ssODN) with the following sequence (atgacgacaaaggccactgcattgaggagcaagatggataatatgtagacttgtgacagagtggattcgacatccatggggaggcagatcgatactttcgtgtaactgctgacaccgacaaggggcaatgtggccatcagggtagaaaaaatccatcctccgagcataattgggatggcatgtctcagcctcagcttttg) was used.
Phenotypic informationHomozygous:
N/A

Heterozygous:
N/A
Breeding history100% C57BL/6NCrl
ReferencesNone available
Homozygous fertilenot known
Homozygous viablenot known
Homozygous matings requiredno
Immunocompromisedno

Information from EMMA

Archiving centreICS, Institut Clinique de la Souris, Illkirch-Graffenstaden, France

Disease and phenotype information

Orphanet associated rare diseases, based on orthologous gene matching

IMPC phenotypes (gene matching)
  • small stomach / IMPC
  • decreased brain size / IMPC
  • small liver / IMPC
  • small lung / IMPC
  • small thymus / IMPC
  • increased lymphocyte cell number / IMPC
  • small spleen / IMPC
  • small heart / IMPC
  • decreased mean corpuscular volume / IMPC
  • increased leukocyte cell number / IMPC
  • thrombocytopenia / IMPC
MGI phenotypes (gene matching)
  • abnormal abdominal fat pad morphology / MGI
  • enlarged adrenal glands / MGI
  • small prostate gland anterior lobe / MGI
  • bulbourethral gland hypoplasia / MGI
  • enlarged spleen / MGI
  • abnormal female reproductive system morphology / MGI
  • abnormal uterus morphology / MGI
  • abnormal ovary morphology / MGI
  • small ovary / MGI
  • impaired ovarian folliculogenesis / MGI
  • absent mature ovarian follicles / MGI
  • absent corpus luteum / MGI
  • abnormal vagina orifice morphology / MGI
  • abnormal male reproductive system morphology / MGI
  • small testis / MGI
  • Leydig cell hyperplasia / MGI
  • small seminiferous tubules / MGI
  • arrest of spermatogenesis / MGI
  • small seminal vesicle / MGI
  • abnormal prostate gland morphology / MGI
  • increased body weight / MGI
  • decreased body weight / MGI
  • abnormal ejaculation / MGI
  • increased circulating follicle stimulating hormone level / MGI
  • increased circulating luteinizing hormone level / MGI
  • abnormal reproductive system physiology / MGI
  • reduced male fertility / MGI
  • male infertility / MGI
  • female infertility / MGI
  • testis hypoplasia / MGI
  • abnormal seminiferous tubule morphology / MGI
  • reproductive system inflammation / MGI
  • cryptorchism / MGI
  • abnormal sexual interaction / MGI
  • abnormal epididymis morphology / MGI
  • delayed vaginal opening / MGI
  • abnormal caput epididymis morphology / MGI
  • abnormal cauda epididymis morphology / MGI
  • oligozoospermia / MGI
  • decreased circulating luteinizing hormone level / MGI
  • small prostate gland / MGI
  • decreased circulating testosterone level / MGI
  • increased circulating testosterone level / MGI
  • abnormal testes secretion / MGI
  • abnormal ovarian secretion / MGI
  • absent Leydig cells / MGI
  • decreased circulating follicle stimulating hormone level / MGI
  • enlarged seminal vesicle / MGI
  • early sexual maturation / MGI
  • abnormal vagina development / MGI
  • epididymal inflammation / MGI
  • prostate gland inflammation / MGI
  • scrotum hypoplasia / MGI
  • increased kidney weight / MGI
  • abnormal sperm physiology / MGI
  • decreased testis weight / MGI
  • decreased ovary weight / MGI
  • increased seminal vesicle weight / MGI
  • decreased seminal vesicle weight / MGI
  • increased epididymis weight / MGI
  • decreased epididymis weight / MGI
  • small epididymis / MGI
  • epididymis hypoplasia / MGI
  • abnormal epididymis epithelium morphology / MGI
  • enlarged prostate gland / MGI
  • increased prostate gland weight / MGI
  • prostate gland hypoplasia / MGI
  • seminal vesicle hypoplasia / MGI
  • decreased circulating estradiol level / MGI
  • increased circulating estradiol level / MGI
  • decreased circulating progesterone level / MGI
  • small penis / MGI
  • abnormal anogenital distance / MGI
  • reproductive system phenotype / MGI
  • Leydig cell hypoplasia / MGI
  • thin myometrium / MGI
  • thin endometrium / MGI
  • abnormal male germ cell apoptosis / MGI
  • absent estrous cycle / MGI
  • absent estrus / MGI
  • thin uterus / MGI
  • thin uterine horn / MGI
  • decreased endometrial gland number / MGI
  • absent endometrial glands / MGI
  • external male genitalia atrophy / MGI
  • vas deferens hypoplasia / MGI
  • abnormal testosterone level / MGI
  • increased urine major urinary protein level / MGI
  • increased adrenal gland weight / MGI
  • abnormal adult Leydig cell differentiation / MGI
  • decreased epididymal cell proliferation / MGI

Information on how we integrate external resources can be found here

Order

Availabilities

Requesting frozen sperm or embryos is generally advisable wherever possible, in order to minimise the shipment of live mice.

  • Frozen sperm. Delivered in 4 weeks (after paperwork in place). €1740*
  • Rederivation of mice from frozen stock, delivery time available upon request . €3880*

Due to the dynamic nature of our processes strain availability may change at short notice. The local repository manager will advise you in these circumstances.

* In addition users have to cover all the shipping costs (including the cost for returning dry-shippers, where applicable), as well as a CRISPR surcharge.

More details on pricing and delivery times

Practical information

Genotyping protocol

Example health report
(Current health report will be provided later)

Material Transfer Agreement (MTA)
Distribution of this strain is subject to a provider MTA. Both signing of the MTA and submission of the online EMMA Mutant Request Form are required before material can be shipped.

EMMA conditions
Legally binding conditions for the transfer

Right strain for your research?

The information provided on this page is, to the best of EMMA’s knowledge, based on data supplied by the original provider. End users are responsible for reviewing these details and for validating the strain and its suitability for their experimental use.​
Not found what you were looking for? Search here for other strains available from EMMA.


Search
INFRAFRONTIER® and European Mouse Mutant Archive - EMMA® are registered trademarks at the European Union Intellectual Property Office (EUIPO).